Ana səhifə

Table S7 Validation of raw sequences of 13 genes of interest (goi) by sequencing of their pcr products. Shared identities between raw sequences and sequences of their corresponding pcr amplicons varied from 91. 05 to 100%. Number


Yüklə 69.16 Kb.
tarix10.06.2016
ölçüsü69.16 Kb.
Table S7 Validation of raw sequences of 13 genes of interest (GOI) by sequencing of their PCR products. Shared identities between raw sequences and sequences of their corresponding PCR amplicons varied from 91.05 to 100%.

Number

Gene ID

Gene description

Homological species

Nr-ID

Primer sequences (forward/reverse)

Blast cds of raw sequences

Amplicon sequences (bp)

Amplicon length (bp)

Identity(%)

1

Unigene12471_All

Coumaroyl-CoA ligase

Vitis vinifera

gi|371534669|gb|AEX32786.1|

TCCACATCTACTCCCTCAACTCC/

CAGGAACCTCACCAGCAACT

ACGGAAACGGTAGAAGAAGGATTCGACTCATCGGAGGCGGTGGCGCTGCCGTTCTCCTCGGGAACAACAGGGCTACCAAAGGGGGTGGTGCTGACGCACAAGAGTCTGATAACGAGCGTCGCACAACAAGTGGACGGGGAAAACCCGAATCTCTACCTGACCCCGGACGATGTCGTTTTGTGCTTGCTTCCCCTATTCCACATCTACTCCCTCAACTCCGTCCTCCTCTGCGCCATGAGGGCCGGCAGCGCCGTCCTCCTCGTCCACAAGTTCGAGATCGCCGCCCTGCTCGAGCAGCTCGAGCGCCACCGCGTCACGGTGGCCGCCGTTGTCCCGCCTCTCGTCCTGGCCCTCGCCAAGAATCCGATGGTGGAGAAGTTCGACCTCGGCGCCATCAGGGCGGTGCTCTCCGGGGCGGCGCCGCTTGGAAAGGAGCTCGAGGACGCCCTCCGGAGTCGGCTCCCGCAGGCCGTTCTCGGTCAGGGTTATGGAATGACGGAGGCAGGGCCAGTGTTAGCAATGTGCCTGGGATTTGCAAAGGAGCCCTTCCCCACCAAGCCCGGCTCTTGTGGATCCGTCGTCCGCAACGCTGAGATGAAGGTTGTCGATCCCGAAACCGGATCCTCTCTCGGCTTCAATCAACCCGGTGAGATCTGCATCCGTGGAGATCAGATCATGAAAGGGTATCTAAACGATGACGCGGCCACAGCTGCAACCATAGACGCCCAAGGCTGGCTTCATACTGGGGACATTGGCTACGTCGATGAAGACATCGAGGTTTTCATTGTCGACCGAGTAAAGGAGATCATTAAATTCAAAGGATTCCAGGTAGCGCCAGCAGAGCTAGAGGCGCTTCTAGTGAGCCATCCCTCCATAGCCGATGCAGCCGTTGTCCCGCAAAAGGATGAAGTTGCTGGTGAGGTTCCTGTGGCGTTTGTGGTTCGGTCTGAAGGGTTTGAGCTTACAGAAGATGCAGTCAAAGAATTCGTAGCAAAGCAGGTGGTTTTCTACAAGAAGCTGCACAAGGTGTACTTTGTTCACGCGATCCCGAAGTCTCCGTCTGGTAAAATCCTGAGGAAAGAGCTCCGAGCTAAGTTGGCT

TTCCACATTCTTACCCTCAACTCCGTCCTCCTCTGCGCCATGAGGGCCGGCAGCGCCGTCCTCCTCGTCCACAAGTTCGAGATCGCCGCCCTGCTCGAGCAGCTCGAGCGCCACCGCGTCACGGTGGCCGCCGTTGTCCCGCCTCTCGTCCTGGCCCTCGCCAAGAATCCGATGGTGGAGAAGTTCGACCTCGGCTCCATCAGGGCGGTGCTCTCCGGGGCGGCGCCGCTTGGAAAGGAGCTCGAGGACGCCCTCCGGAGTCGGCTCCCGCAGGCCGTTCTCGGTCAGGGTTATGGAATGACGGAGGCAGGGCCAGTGTTAGCAATGTGCCTGGGATTTGCAAAGGAGCCCTTCCCCACCAAGCCCGGCTCTTGTGGATCCGTCGTCCGCAACGCTGAGATGAAGGTTGTCGATCCCGAAACCGGATCCTCTCTCGGCTTCAATCAACCCGGTGAGATCTGCATCCGTGGAGATCAGATCATGAAAGGGTATCTAAACGATGACGCGGCCACAGCTGCAACCATAGACGCCCAAGGCTGGCTTCATACTGGGGACATTGGCTACGTCGATGAAGACATCGAGGTTTTCATTGTCGACCGAGTAAAGGAGATCATTAAATTCAAAGGATTCCAGGTAGCGCCAGCAGAGCTAGAGGCGCTTCTAGTGAGCCATCCCTCCATAGCCGATGCAGCCGTTGTCCCGCAAAAGGATGAAGTTGCTGGGAAAGGTTCCTGAA

736

98.64

2

Unigene43841_All

Cinnamate 4-hydroxylase

Fagopyrum esculentum

gi|314910736|gb|ADT63059.1|

GAGCTAGTAAACCACCCAGACA/

GGTAAGGGAGGTTGGTGAGAT

ATAGCAGAGCTAGTAAACCACCCAGACATCCAAGCCAAGCTTCGAGCCGAGCTCGATACCGTCCTGGGCAAAGGAGCCCAGATAACCGAGCCCGATCTCACCAACCTCCCTTACCTCCAA

GAGCTAGTAAACCACCCAGACATCCAAGCCAAGCTTCGAGCCGAGCTCGATACCGTCCTGGGCAAAGGAGCCCAGATAACCGAGCCCGATCTCACCAACCTCCCTTACCT

110

100.00

3

Unigene19556_All

cinnamate 4-hydroxylase

Salvia miltiorrhiza

gi|85720056|gb|ABC75596.1|

CCGCAGTTGGAACCTGAGAAG/

AGGCAGAGGCTTACCGTTAGG


GAACTCGACACCGTCCTCGGAAAGGGCGTCCAGATAACGGAGCCCGACATCCAAAGACTCCCTTACCTTTACGCCGTCATCAAGGAAGCGCTCCGTCTCCGAATGGCAATCCCTCTGCTGGTCCCACACATGAACCTCGACGACGCCAAGCTGGCGGGCTACGACATCCCGGCGGAGAGCAAGATCCTGGTCAACGCCTGGTGGCTGGCCAACAACCCCGACACCTGGAAGAATCCCGAGGAGTTCCGCCCCGAACGCTTCTTGGAAGAAGAGTCCAAGGTTGACGCCAACGGTAACGATTTCCGTTACTTGCCGTTTGGCGTCGGACGGAGGAGTTGCCCCGGTATTATTCTGGCCTTGCCTATTGCGGGAATTACCGTTGGGAGGTTGGTTCAGAATTTCGAGCTTCTTCCGCCGCCAGGGAAGGACAAGGTTGATACTTCTGAGAAAGCTGGGCAATTTAGCTTGCAGATTCTTAACCACTCCACCATTGTTCTTAAGCCAAGGAGC

TGAGCCCGAACACCAAAGACTCCCTTACCTTTACGCCGTCATCAAGGAAGCGCTCCGTCTCCGAATGGCAATCCCTCTGCTGGTCCCACACATGAACCTCGACGACGCCAAGCTGGCGGGCTACGACATCCCGGCGGAGAGCAAGATCCTGGTCAACGCCTGGTGGCTGGCCAACAACCCCGACACCTGGAAGAATCCCGAGGAGTTCCGCCCCGAACGCTTCTTGGAAGAAGAGTCCAAGGTTGACGCCAACGGTAACGATTTCCGTTACTTGCCGTTTGGCGTCGGMCGGAGGAGTTGCCCCGGTATTATTCTGGCCTTGCCTATTGCGGGAATTACCGTTGGGAGGTTGGTTCAGAATTTCGAGCTTCTTCCGCCGCCAGGGAAGGACAAGGTTGATACTTCTGAGAAAGCTGGGCAATTTAGCTTGCAGATTCTTAACCACTCCACCA

452

98.89

4

CL2476.Contig2_All

UDP-glucosyltransferase

Ricinus communis

gi|223546179|gb|EEF47681.1|

CCCAGGATCGCCTTCTACACCT/

TCGTCGAGCCAGCTTAACACCT

ATCCCCAGGATCGCCTTCTACACCTCCGGATCCTTCGTTTCCTCCGTCAGCGCCACTCTGTTTTCCGACGTTGCGAGATTCAAGGCGCTCGATTCCGTCCAATTTACCGATCTGCCGCGCTCCCCTGTTTTCAAGGAGGAGCATCTGCCAACCGTCTTCAGACTCTACAACGAATCCGATCGCAGTTCTCATGCTATCAAGGACGGATTGATGGCGAACTTGTCCAGCTGGGGCTGCGTTTACAATTCGTTTCGCGCCCTCGAAGGCGACTACTTGGAGCATATCACGAAGGTGACCGTCAACGGGAGAGTCTACGGCGTCGGTCCGGTTAGTTTGTTCAAGGAATCCGCGACTCTAAGTCGGGTCAACCCGGATCAGGATGTTAACTGCGAGGTGTTAAGCTGGCTCGACGATTGCCCG

TCCCAGGATTCGCTTCTACACCTCCGGATCCTTCGTTTCCTCCGTCAGCGCCACTCTGTTTTCCGACGTTGCGAGATTCAAGGCGCTCGATTCCGTCCAATTTACCGATCTGCCGCGCTCCCCTGTTTTCAAGGAGGAGCATCTGCCAACCGTCTTCAGACTCTACAACGAATCCGATCGCAGTTCTCATGCTATCAAGGACGGATTGATGGCGAACTTGTCCAGCTGGGGCTGCGTTTACAATTCGTTTCGCGCCCTCGAAGGCGACTACTTGGAGCATATCASGAAGGTGACCGTCAACGGGAGAGTCTACGGCGTCGGTCCGGTTAGTTTGTTCAAGGAATCCGCGACTCTAAGTCGGGTCAACCCGGATCAGGATGTTAACTGCGAGGTGTTAAGCTGGCTCGACGA

411

98.78

5

CL8199.Contig1_All

UDP-glucose glucosyltransferase

Fragaria x ananassa

gi|51705413|gb|AAU09444.1|

CTCTCCATCACCGTCCTCCT/

CGTCGAGTTCCATCCACAGT

ATTTCAAAGACGGCAAATCTAGTACTGATCCCAGCTCCGGGAATGGGCCACCTTGCCCCCGCCATAGAGCTGGCCAAGCACCTGGTGGCCCGGGATCCGCGCCTCTCCATCACCGTCCTCCTCATCAAGGGTTTCGTCCCCGAGGAAACGCTCGAATCTTATATCCTCTCTCTGAAATCCAACTCCTCTCTTCTCAACCAAGGCATCGGATTCATTGATATTCCCCAAATCGACCTCAACTCCGCCAGACCGAGCTTCTTGACTCACATGAACGCCTACCAACCCAAAGTCAAGGAAGCCATCGAGGGTCTTCGATCCGCGGGTCCCCTGCCCGTTGCGGGGCTCCTCGTGGACATGTTCTGCACTTCCACGATCGATGTGGCAACAGAGCTTGGGCTACCGTCTTACGTCTTCTTCACCTCCGGCGCCGGCCTTCTCCGCATGTTTTTCCACCTCCATGGATTAGGGGTCGATGTGGCGCAGGAATACGATGTCGTTCGGAGCCCGGATACGTTGTTGGAGATTCCAGGGTTTCGAAATCCGGTGCCGGTGAAAGTTTTGCCGGGGAGATTCCTGTCTAAAGACGGTCAGTCATCCACGTTCTTGCGCCTCGCTGACAAGTTCCGCCAGGCCAAGGGTATTTTGGTAAATACATGCATGGAGATTGATCGGGACTTAATCCAGTCCATGTCGCAGCAAGACATCGAAATCCCACCGATCTACCCGGTGGGGCCCATCCTCAACCTGCCGACTGAAGATGATCATGGTCATGATGATGACGAGTCCTCCGGGAAAGATCCAATCACGAGGTGGCTGGACGACCAGCCGCCTCGATCCGTGGTGTTCCTCTGCTTCGGGAGCAGGGGAACCTTCAACGACACGCAGATCAAAGAGATCGCCGTCGGGCTCGAGCGAAGTGGCCAACGCTTTCTGTGGTCCCTCCGGCAACGACCCGGTGAGACCGGGGTTCCATTGGAATTAGATGATCCTAGTAAGGTGTTGCCGGAGGGGTTTTTTGAGCGGACAGCCGAGAAAGGGAGGGTCATAGGGTGGGCCCCGCAGGCGAGGGTGTTGGCCCACAAGGCGGTTGGGGCATTCGTGTCGCACTGTGGATGGAACTCGACG

TCTCTTCTCAACCAATGGCATCRGAYWCATYGATATTCYCCAAATCGACCTCAAMTYCGCCAGAMCGAGCTTCTTGACTCACATGAACGCYTACCAACCCAAAGTCAAGGAAGMCATCGA GGRTSTYMGATCCGCKGGTCCCYTSSCCGTTGCGGGGCTCCTCGTGGACATGTTCTGCACTTCCACGATCGATGTGGCAACAGAGCTTGGGMYASMGTCTKACGTCTTSTTCACCTCCGGCGCCGGCYTTSTCCGCKTGTTTTTCCACCTCCATGGATTAGGGGTCGATGTGGCGCAGGAATASGATGTCGTTCGGAGCCCGGATACGTTGYTGGAGATTCCAGGGTTTCGAAATCCGGTGCCGGTGAAAGTTTTGCCGGGGARATTCCTGTCTAAAGACGGTCAGTCATCCACGYTCTTGCGCCTCGYTGACAAGTTCCGCCAGGCCAAGGGTATTTTSGTAAATACATGCATGGAGATTGATCGGGACYTAATCCAGTCCATGTYGCAGCAAGACATCGAAMTCCCACCGATCTACCCGGTGGGGCCCATCCTCAACCTGCCGACYGAAGATGATCATGGTCATGATGATGACGAGTCCTCCRGGAAAGATCCAATCACGAGGTGGCTGGACGACCAGCCGCCTCGATCCGTGGTGTTCCTCTGCTTCRGGAGCAGGGGAACCTTCAACGACACGCASATCAAAGAGATCGCCGTCGGGCTCGAGCGAAGTGGCCAACGCTTTYTGTGGTCCCTCCGGCAACGACCCGGTGAGACCGGGGTTCCATTGSAWTTAGATGAKCCTAGTAAGGTGTTGCCKGAGGGGTTTTTTGAGCGGACAGCCGAGAAAGGGAGGGTCATA

862

94.77

6

Unigene6757_All

glucosyltransferase

Nicotiana tabacum

gi|14349253|dbj|BAB60721.1|

CCATCTCCTCGCCGAAGTTG/

CCGTTACTCCGTCGTTAGCCT

GCCGAACTCATCCTCTTCGCCGGCCCGGAGGTGGGCCATCTCCTCGCCGAAGTTGAGGTTAGCCGGCGAGTCACATCCTTAGACGCCCAAATCTCCATAGCCATCCTCATCCCCAAGCTCCCCGTCCCCAACGAAAACCTCGACGTCTTCATCAAATCCCTCGACGCCGACCTCCGCCGCGACCCCGACCCGCGAATCTCCGTCGTCGAGCTTCCGCCGCTGGACGACGTCCCGCCGGAGCTGACCCAACCCGGGAACCACGTCCTCCTAGTCGACAGCCTCGCGGGTCTCTACAAGCCGATCGTGAAGCGCACGGTCGAGGAGCGCCGGCTCCGGCGCAAAACCGCCGGAATCGTCTTCGACATGTTCTGCGCGCCGATGGTCGACGTGGCGGAGGAGCTCGGCGTGCCGTCCTACTTGTTCTACACCTCCGGCGCTAACATGCTCAGCTTAACTCTCAAGCTGGAGTCGCTCGCGGCGGACGACCTGCCGGCGCTCTTCGAAGGAATGTCGCCGGAGTCAACGCCGGTCGAATTCCCGGGATTCAAGAATCCCGTGCCGTTGAAGGTCTGGCCCGAGCTCTATCTAAACAAAGGGGCAGCGCTCTGGGCCCACTTCATGCGGTTCGCTTCTCAGTATCGCAAAACCAAGGGCATTTTGGTAAATACATTCACCGAGTTGGAGTCGGAACTCCTTAAGTCCTTGAACGAAAACGAACGTTTTCCTCCCGTTTATTCCGTGGGCCCCATCCTCAACCTCGGTCGTAAGGCTAACGACGGAGTAACGGAATCGCCTCGGGATCCGACGCTGAGTTGGTTAGACGAGCAACCGGCTGGGTCGGTGGTTTTCTTCTGCTTCGGGAGCAAG

GCGAAGTTGAGGTTAGCCGGCGAGTCACATCCTTAGMYKSMSMMMTYYYCMKAGCCWTCCTCATCCCCAAGCTCCCCGTCCCCAACGAAAACCTCGRCGTCTTCATCAAATCCCTCGACGCCGACCTCCGCCGCGACCCCGACCCGCGAATCTCCGTCGTCGAGCTTCCGCCGCTGGACGACGTCCCGCCGGAGCTGACCCAACCCGGGAACCACGTCCTCCTAGTCGACAGCCTCGCGGGTCTCTACAAGCCGATCGTGAAGCGCACGGTCGAGGAGCGCCGGCTCCGGCGCAAAACCGCCGGAATCGTCTTCGACATGTTCTGCGCGCCGATGGTCGACGTGGCGGAGGAGCTCGGCGTGCCGTCCTACTTGTTCTACACCTCCGGCGCTAACATGCTCAGCTTAACTCTCAAGCTGGAGTCGCTCGCGGCGGACGACCTGCCGGCGCTCTTCGAAGGAATGTCGCCGGAGTCAACGCCGGTCGAATTCCCGGGATTCAAGAATCCCGTGCCGTTGAAGGTCTGGCCCGAGCTCTATCTAAACAAAGGGGCAGCGCTCTGGGCCCACTTCATGCGGTTCGCTTCTCAGTATCGCAAAACCAAGGGCATTTTGGTAAATACATTCACCGAGYWGGAGTCGGAACTCCWTAAGTCCTTGAACGAAAACGAACGTTTTCCYCCCGTKWWTTCCGTGGGCCCCATCCTCAACCTCGGTCGTAAGGCTAACGCG

731

96.44

7

Unigene15430_All

UDP-glucosyltransferase

Ricinus communis

gi|223537474|gb|EEF39100.1|

ACCCTTCCCTCATCACTTTCC/

GGCATCCTTCACAGCCTTACT

TCCAAGTTCCACATCCTCATGTTCCCGTGGCTCGCCATCGGCCACATAACTCCCTACCTCCACCTCTCCAACAAACTCGCCGAAAAAGGCCACAAAATCACATTCCTCCTCCCAAACAAGGCTCAAGTCCTCCTCCAACACCTCAACCTCCACCCTTCCCTCATCACTTTCCACCCACTCTCGATCCCCCAAGTGGAAGGCCTTCCTCTTGGCACCGAGACTGCCTCGGACGTCCCCATCTCCCTCACACGCTTTCTCGCCATCGCATTCGACCTGACGCGCCCCCAAGTCTCACAAATCATACTCGACCTCAAACCGGATTTCGTCTTCTACGACTTCGCTCACTGGGTCCCCGAGATCACGTCCAAGCTCGGGATCAAGTCGGTATGTTATAACGTAGTATGCGCCGCCGCCCTGGCCCATAACATGGTCCCCGTGCGTTACACTTGTCACCCTCCACTTACGGCGGAGCAGGTGGAGGAGCTGGTTGCGCCGCCCGCAGGATACCCCATGGCGCTTTTGCACAAGCACGAGGCGCGTAAGCTCGTGTTCATGGCCCAAGAATATGGCAGCGGAATCACCTTCTTCGAGAGGCTCAACTCGGCACTGAAGTTGGCCGACGCCATCGCTATCAGGACTTGCAAGGAGATCGAGGGGAAGTTCTGTGATTACCTCAGCAGCCAGTTTGAGACATCAGTGTTACTCACGGGCCCCGTGTTGCCGGACTTGACCACCACCGAAGGGACGGCGTTGGATGAGAAATGGGCGAGCTGGCTCGGAGCCCACGAACCGGGTTCAGTGATTTACTGCGCGTTCGGGACCCAGTGTTTCCTTGACAAGCACCAGTATCAGGAGATTCTTTTAGGGTTCGAGTTAACTGGTTATCCGTTCTTTGTGGCCCTAAAGCCTCCTACGGGATGCTCGACGATAGAGGAGGCTTTACCAGAGGGGTTTGAAGAGCGGGTCAGGGGGAAGGGGGTGGTTTACGGAGGGTGGGACATCCAGCAACCGCTCATACTGGAGCACCCGTCGGTTGGGTGCTTCGTGAGCCATTGTGGGTTCGGGTCCATGTGGGAGTCGCTTATGGGGAAGCCTCAAATAGTGTTGGTGCCACAGCAGGGTGACCAGGTAATGAATACGAGGATCATGGCGCGAGAGATGAAGGTGGCAGTGGAGGTGGAGAAGGACGAGAGTGGGTGGGTTTCAAGGGAGAGCCTGAGTAAGGCTGTGAAGGATGCCATGGATAAGGAGAGCGTGGTGGGGTGTTTGATTAGAGAGAACCATGCTAAGTGGAGGGAGGTGTTGGGGAGCCCTGGCTTCATGAGTGGTTATGTTGACAGCTTTGTGCATCAATTGGAGAGGCTTTTGGAT

GGAAGGCTTCCTCTTGGCACCGAGACTGCCTCGGACGTCCCCATCTCCCTCACACGCTTTCTCGCCATCGCATTCGACCTGACGCSCCCMMRWSTYYMMMAAATCATAACTCGACCTYMAAACCCGGATTTCGTCTTCTACGACTTCGCTCACTGGGTCCCCGAGGATCACGTCCAAGCTCGGGATCAAGTCGGTATGKTATWACGTAGTAWGCGCCGSCGCCCTGGCCCATAACATGGYCCCCGTGCGTTACACTTGTCACCCTCCACTTACGGCGGCGCAGGTGGAGGAGCTGGTTGCGCCGCCCGCAGRATACCCCATGGSGCTTTTGCACAAGCACGAGGSGCGTAAGCTCGKGTTCATGGCCCAAGAATATGGCAGCGGAATCACCTTCTTCGAGAGGYTCAACTCGGCACTGAAGTTGGCCGACGCCATCGCTATCAGGACTTGCAAGGAGATCGAGGGGAAGTTCTGTGATTACCTCAGCAGCCAGTTTGAGACATCAGKGTTACTCACGGGCCCCGCGTTGCCGGACTTGACCACCACCGAAGGRACGGCGTTGGATGAGAAATGGGCGAGCTGGCTCGRAGCCCACGAACCGGGTTCAGTGATTTACTGCGCGTTCGGRACCCAGTGTTTCCTTGACAAGCACCAGTTTCAGGAGATTCTTTTAGGGTTCGAGTTAACTGGTTATCCGTTCTTTGTGGCCCTAAAGCCTCCTACGGGATGCTCGACGATAGAGGAGGCTTTACCAGAGGGGTTTGARGAGCGGGTCAGGGGRAAGGGGGKKGTTTACGGAGGGTGGGACATCCAGCAACCGCTCATACTGGAGCACCCGTCGKKKKGSTKCKTSRKSAKYSWKKGTKSGKKYSRKKYSRWGTCGCTATGGGAGYYSMWWWWGKGKRWGCCTCAAATAGTGTTGGTGCCACAGCAGGGTGACCAGGTAATGAATACGAGGATCATGGCGCGAGAGATGAAGGTGGCAGTGGAGGTGGAGAAGGACGAGAGTGGGTG


1014

92.13

8

CL554.Contig1_All

glucosyltransferase

Nicotiana tabacum

gi|62241063|dbj|BAD93688.1|

AGCCGTTGAGCTTACAGGTTAC/ TGGTATCAGTGGTGTGGAGAGT

ATGGCTTCAGAACCCAAAAAAGCCCATTTTGTAGTGTTTCCAATGATGCAACAAGGCCACATGATCCCAATGGTAGACATCGCAAGGCTCATAGCAAGGCACGGCACAACCGTCACCATAGTCACCACACCTCTCAACGCTCTCCGTTTCAAAGCCACCCTCGATCACGACGTCGAAACTGAAGCATTGGACATTCGAGTTGCCGAAATCGAATTCCCTTCCAAGGAAGCGGGATTTCCCGAAGGAATCGAAAATGCCGACATGTTGCCTTCCCTCGGTTTGGTCGAATCATTCGTCGTTTCCACCAGCTTGCTTCATGATCAATCTGAGAAGCTTTTCTCAGAGCTTAAGCCCAAACCAACTTGCATTTTGTCCGACGTCATATTTCATTGGACAATTGATATTGCTAAGAGGTATGGTGTTCCAAGAATTGTGTTTCATGGTCTTGGTTGCTTTGCTTTACTCTGCTCTCACAATTTGATCAAGTCTAAGGTTCTTGATAGTATAACCTCTGACACAGAGCAAGTTGTAGTGCCTGATCTGCCAGATGAGATTGTTCTTACCAAAGATCAGCTTCCCAATAGCCTTAGGCCAGGGTCTTCGGCCCTAAAAGATCGAACTACGCGTATTAGAGCAGCTGAAGAAGAATCGTTTGGGATTGTAGTGAATTCTTTCGAGGAATTGGAGGTCGAATATATGAAGAGATACAAAGAGGCGAAGTCGCCAAAGAAGGTTTGGTTTGTTGGTCCTGTTTGCTTGAGCAACAAAGATAATGCAAGCAAGGGTGACAGAGGCAACAAATCTTCTGTTGATGGAAATTTATGTTTGAAATGGCTTGAGAATCGTGAACCGGGTTCTGTAATCTATGCTTGCCATGGAACCCTTTGCTCGTTCAACACGCGACAAATGATGGAGCTCGGTTTAGGCTTGGAGGAATCGAAAAAATCTTTCGTATGGGTTATAAGAAGACGAGACGGGTTGGAGGAACTCGAGAAGTGGATGAAGGAAAGCGGGTTCAAAGAAAGGATTAAAGATAGAGCATTAGTGATTTGGGGATGGGCACCACAAGTGTTGATATTGTCACACCCTTCAATAGGTGGATTCTTGACACACTGTGGATGGAACTCGACTCTAGAAGGGGTGTGCGCGGGTTTGCCAATGGTGACATGGCCAATGTTTTCGGACCAATTCTATAATGAGAAGTTGATTACACAAATATGGAAGATTGGTGTGACAGTCGGAGTGAAGAGTCCTGTGAAGTTTGAGGAAGAGAAAATGTTGTCTATTTTGGTGAAGAAAGAAGACGTTGCGAAGGCGGTGGAGGCGATAATGGAGGACGGAGAAGAAGGGAGGAAGAGAAAGGAAAGGGCAAGAGAGTTGGGAAATATGGCTAGAGAAGCGTTTGGAGAGGGTGGCTCTGCTTATTTGAGTATGAAATCTTTAATCAACGATATTTTACAACAA

CAGGCACGGCACAACCGTCACCATAGTCACCACACCTCTCAACGCTCTCCGTTTCAAAGCCACCCTCGATCACGACGTCGAAACTGAAGCATTGGACATTCGAGTTGCCGAAATCGAATTCCCTTCCAAGGAAGCGGGATTTCCCGAAGGAATCGAAAATGCCGACATGTTGCCTTCCCTCGGTTTGGTCGAATCATTCGTCGTTTCCACCAGCTTGCTTCATGATCAATCTGAGAAGCTTTTCTCAGAGCTTAAGCCCAAACCAACTTGCATTTTGTCCGACGTCATATTTCATTGGACAATTGATATTGCTAAGAGGTATGGTGTTCCAAGAATTGTGTTTCATGGTCTTGGTTGCTTTGCTTTACTCTGCTCTCACAATTTGATCAAGTCTAAGGTTCTTGATAGTATAACCTCTGACACAGAGCAAGTTGTAGTGCCTGATCTGCCAGATGAGATTGTTCTTACCAAAGATCAGCTTCCCAATAGCCTTAGGCCAGGGTCTTCGGCCCTAAAAGATCGAACTAYGCGTATTAGAGCAGCTGAAGAAGAATCGTTTGGGATTGTAGTGAATTCTTTCGAGGAATTGGAGGTCGAATATATGAAGAGATACAAAGAGGCGAAGTCGCCAAAGAAGGTTTGGTTTGTTGGTCCTGTTTGCTTGAGCAACAAAGATAATGCAAGCAAGGGTGACAGAGGCAACAAATCTTCTGTTGATGGAAATTTATGTTTGAAATGGCTTGAGAATCGTGAACCGGGTTCTGTAATCTATGCTTGCCATGGAACCCTTTGCTCGTTCAACACGCGACAAATGATGGAGCTCGGTTTAGGCTTGGAGGAATCGAAAAAATCTTTCGTATGGGTTATARGAAGACGAGACGGGTTGGAGGAACTCGAGAAGTGGATGARGRAARSSGGKTYSRAAGAAAGGATTAAAGATAGAGCATTAGTGATTTGGGGATGGGCACCACAAGTGTTGATATTGTCACACCCTTCAATAGGTGGATTCTTGACACACTGTGGATGGAACTCGACTCTAGAAGGGGTGTGCGCGGGTTTGCCAATGGTGACATGGCCAATGTTTTCGGACCAATTCTATAATGAGAAGTTGATTACACAAATATGGAAGATTGGTGTGACAGTCGGAGTGAAGAGTCCTGTGAAGTTTGAGGAAGAGAAAATGTTGTCTATTTTGGTGAAGAAAGAAGACGTTGCGAAGGCGGTGGAGGCGATAATGGAGGACGGAGAAGAAGGGAGGAAGAGA

1264

99.05

9

Unigene15235_All

Cytochrome P450

Glycine max

gi|225458057|ref|XP_002278387.1|

CGGTCATCGGTAACCTCCAC/

TGTTTCCTTCACCACTGCCTTC

CTCTTCTTGCAGCTTCTTCTTGCACTCTTTGTTGCTTCCTTTATCTTCCTCATACAAAAGAATAAGAAAAAAGCTAGTCAACCTCCGGGGCCACCTGGGCTTCCGGTCATCGGTAACCTCCACCAGTGTGCTTCCACTACCCCTCACCTCTACTTTCATGAACTATGCAAAACCTACGGGCCCTTAATGTCTTTGAAACTCGGGTTTGTACCAACCCTTGTGGTTTCCTCGGCAAAAATGGCCAAGGAAGTACTGAAAACCCATGACAACGTCTTCGCTAGCAGGCCAAAGTTGTTAAATCAACAAAAACTATTTTACAATGGGTTAAGCATAACCCTATTACCCTATGGCGATCACTGGAGAGAAATTAGGAAAGCCTGTATAGTTCATCTCTTTAGTCCTAAGAGAGTCCAGTCCTTCTCTTCAATTCGAGAAGATGAGGTTTATCAGATGACGCGGGAGATATCGTGTTTGGGCAATAAAAAGAAGCCGGTAAATTTAAGTGAAATGATGATATGCGTTATCAACACAATAGTATGTAGAGTTGCTTTTGGGAGGAGGGAAGAGGTTGATAATGCCAAGTATAGAAGTAATCTCCAAGTCATGCTTAGGGTTATACAAGAATTGCTTGTTAGTTTTTCTTTTTCCGATTATTTTCCTCTTATGGGTTGGGTGGATAAGATCAGGAGGCTAATGCATCCCCAATTCAATAAGGTTTCTATGGAGTTGGATGGCCTTCTTGAGGAAATCATTGACGAGCATGTGAAGACAAAATCTAGCCGAGAAGAAGAGGAAGACATTGTTGATGTGCTACTCAGGCTCCAACGACAGAATTCATTTGGATTCGACATTAACCGTGATCACATCAAAGCAACTCTTATGGATTTATTCGTGGCAGGGACAGATACAGCTGCAGGAACAATAGTTTGGGCAATGACGGAGCTTATGAGGAATCCAAAGGCAATGAAGCAACTGCAAGAAGAAGCAAGAACAACATTGATGGGTAAAGACACTATAAAAGAAGCAGATCTTGGAAAGCTAGTGTATTTGAAGGCAGTGGTGAAGGAAACATTGAGATTGCACCCGGCAGCTCCATTGCTAGTCCCCCGAGAAGCCAATCAAAGTTGCATAATTGACGGGTACGAAATCAAAAAGAAAACCTTAGTCTATGTAAATGCATATGCAATTGGAAGGGACCCTGAAGCCTGGGAAAACCCGGAT

TCCGTCACACGGGGGTCTCACCAGTGTGCTCACTACCCTCACTCTAYKWWCWWKRCWAWRCMWACKRSSSSYYWAWKKYYTTGAAACTCGGGTTTGTACMAMCYSTKGTGGTTTCCTCGGCAAAAATGGCCAAGGAAGTACTGAAAACCCATGACAACGTCTTCGCTAGCAGGCCAAAGTTGTTAAATCAACAAAAACTATTTTACAATGGGTTAAGCATAACCCTATTACCCTATGGCGATCACTGGAGAGAAATTAGGAAAGCCTGTATAGTTCATCTCTTTAGTCCTAAGAGAGTCCAGTCCTTCTCTTCAATTCGAGAAGATGAGGTTTATCAGATGACGCGGGAGATATCGTGTTTGGGCAATAAAAAGAAGCCGGTAAATTTAAGTGAAATGATGATATGCGTTATCAACACAATAGTATGTAGAGTTGCTTTTGGGAGGAGGGAAGAGGTTGATAATGCCAAGTATAGAAGTAATCTCCAAGTCATGCTTAGGGTTATACAAGAATTGCTTGTTAGTTTTTCTTTTTCCGATTATTTTCCTCTTATGGGTTGGGTGGATAAGATCAGGAGGCTAATGCATCCCCAATTCAATAAGGTTTCTATGGAGTTGGATGGCCTTCTTGAGGAAATCATTGACGAGCATGTGAAGACAAAATCTAGCCGAGAAGAAGAGGAAGACATTGTTGATGTGCTACTCAGGCTCCAACGACAGAATTCATTTGGATTCGACATTAACCGTGATCACATCAAAGCAACTCTTATGGATTTATTCGTGGCAGGGACAGATACAGCTGCAGGAACAATAGTTTGGGCAATGACGGAGCTTATGAGGAATCCAAAGGCAATGAAGCAACTGCAAGAAGAAGCAAGAACAACATTGATGGGTAAAGACACTATAAAAGAAGCAGATCTTGAAAGCTAGTGTATTTGAAGGATGTGGG

948

93.54

10

CL1442.Contig1_All

Cytochrome P450

Populus trichocarpa

gi|224089905|ref|XP_002308860.1|

GAACGACGAGGGCGTAATC/

GCAACCTTGGAAGAGGGACT

CTCCTCCTCATCACCGTCCTTCTCCTCACCGTCGTCCTCTCCTACCTCCTCTACAACCGCCTCCGGTTCAAGCTCCCGCCGGGCCCAAGGCCCTGGCCCGTCGTCGGGAACCTCTACGACATCAAGCCCGTTCGCTTCCGTTGCTTCCACGAATGGGCCCAACGCTACGGGCCCATCATATCGGTGTGGTTCGGGTCCAACCTCAACGTGATCGTGTCGAACACCGAGCTGGCTCGGGAGGTGCTCAAGGAGAAGGACCAGCAGCTGGCGGACCGCCACCGGAGCCGGTCAGCGGTCCGGTTCAGCCGCAACGGGGCGGATCTCATATGGGCCGACTACGGGCCTCACTATGTGAAGGTGAGGAAGGTGTGTACGTTGGAGCTTTTTACGCCTAAGAGGCTTGAATCTCTTAGGCCCGTTAGGGAGGATGAGGTTACCGCCATGATTGAATCCATCTACAAAGATTGCACCTCTCATGAAACCCATGGGAAGAGCCTGACGCTGAAGAAATACTTAGGAGCCGTGGCCTTCAACAACATAACAAGGCTCGCCTTTGGGAAGCGGTTCATGAACGACGAGGGCGTAATCAACAAGCAAGGGCTCGAGTTCAAGGCCATTGTAGCCAACGGCTTGAAGCTTGGGGCGTCTTTGGCCATGTCGGAGCACATTAACTGGCTCCGGTGGATGTACCCGGTTGAGGAGGAGGCCTTTGCCAAGCACAACGCCCAAAGGGACCGTCTCACAAAGGCCATCATGGATGAGCACACCGCCGCTCGCCAAAAGAGTGGTGACACAAAACAACACTTTGTTGATGCTTTGTTGACACTCAAGGACAAGTATGATCTTAGTGAAGACACCATTATTGGACTTCTTTGGGACATGATCACGGCCGGTATGGATACAACAGCAATCTCAGTAGAATGGGCCATGGCGGAGCTAATCCGAAACCCAAGGACCCAACAAAAGGCCCAAGAAGAGCTTGACCGGGTCATCGGGCATGAACGAATCATGATCGAATCCGACATCTCCAACCTCCCTTACTTGCAAGCTGTGGCCAAGGAGGCGCTCAGGCTACACCCACCAACGCCACTAATGCTCCCCCACCGAGCCAACGCCAACGTAAAAATCGGGGGCTATGACATCCCGAAAGGCTCCATTGTCCAAGTCAACGTGTGGGCTGTGGCCCGTGACCCGGCTGTGTGGAAGGACCCGCTCGAGTTCAGGCCCGAAAGGTACTTTGAGGAGGATGTTGACATGAAAGGGCACGACTTTAGGTTATTGCCTTTCGGGGCGGGTCGACGGGTCTGCCCAGGTGCCCAGCTCGGTATAAACTTGGTCACCTCCATGTTGGGTCATTTGCTGCACCATTTTAGCTGGAGCCCACCCAACGGGCTTAAGCCCGAAGAGATTGACATGTCGGAGAATCCCGGGTTGGTTACATATATGACTTCTCCGTTGCAGACAGTCCCTCTTCCAAGGTTGCCTTCTCAGTTGTACAAAAGGGTACCTGTGGATATG

GTATCAACAAGCAAGGGCTCGAGTTCAAGGCCATTGTAGCCAACGGCTTGAAGCTTGGGGCGTCTTTGGCCATGTCGGAGCACATTAACTGGCTCCGGTGGATGTACCCGGTTGAGGAGGAGGCCTTTGCCAAGCACAACGCCCAAAGGGACCGTCTCACAAAGGCCATCATGGATGAGCACACCGCCGCTCGCCAAAAGAGTGGTGACACAAAACAACACTTTGTTGATGCTTTGTTGACACTCAAGGACAAGTATGATCTTAGTGAAGACACCATTATTGGACTTCTTTGGGACATGATCACGGCCGGYATGGACACAACAGCAATCTCAGTAGAATGGGCCATGGCGGAGCTAATCCGAAACCCAAGGACCCAACAAAAGGCCCAAGAAGAGCTTGACCGGGTCATCGGGCATGAACGAATCATGATTGAATCCGACATCTCCAACCTCCCTTACTTGCAAGCTGTGGCCAAGGAGGCGCTCAGGCTACACCCACCAACGCCACTAATGCTCCCCCACCGAGCCAATGCCAACGTAA

AAATCGCGGGCTATGACATCCCGAAAGGCTCCATTGTCCAAGTCAACGTGTGGGCTGTGGCCCGTGACCCGGCTGTGTGGAAGGACCCGCTCGAGTTCAGGCCCGAAAGGTACTTTGAGGAGGATGTTGACATGAAAGGGCACGACTTTAGGTTATTGCCTTTCGGGGCGGGTCGACGGGTCTGCCCAGGTGCCCAGCTCGGTATAAACTTGGTCACCTCCATGTTRGGTCATTTGCTGCACCATTTTAGCTGGAGCCCGCCCGACGGGCTTAAGCCCGAAGAGATCGACATGTCGGAGAATCCCGGGTTGGTTACATATATGACTTCTCCGTTGCAGACAGTCCTCTCTCACAAGGTGTGTCCAA

906

97.35

11

Unigene19863_All

stilbene synthase

Fallopia multiflora

gi|401710284|gb|AFP97667.1|

AGATGAGGAAGAAGTCGCTTGA/

TTCGTAGCACCACAGTTTCA

GATGAGATGAGGAAGAAGTCGCTTGAAAACGGTCAAGCAACCACCGGAGAAGGACTTGAGTGGGGCGTTCTGTTTGGATTTGGGCCTGGTATTACTGTTGAAACTGTGGTGCTACGAAGTGTGCCCATCTTT

AGGACTTGAGTGGGGCGTTCTGTTTGGATTTGGGCCTGGTATTACTGTTGAAACTGTGGTGCTACGAAA

69

98.55

12

CL4799.Contig3_All

type III polyketide synthase

Polygonum cuspidatum

gi|163867088|gb|ABY47640.1|

GAGTGAACACCTCACCCACCTC/

TTCCCAAGCTCTGCAACTCCTT

ATGGAGGCTTCAATTGAGGAGATTAGGAAGGCACAAACACCCGCTACCGTCCTGGCCATCGGCACCGCCAACCCTCCCAACTGCATGTACCAAGCCGACTTTCCCGATTATTACTTCCGCATCACCAAGAGTGAACACCTCACCCACCTCAAGCAAAAATTCAAGCGCATTTGTGATAATTCAATGATCGAGAAGCGTTACTTTCAATTGACCGAAGAGATTATCAAGGAAAACCCAAATATTGGTGCCTATGAGGCACCGTCATTGAATGCAAGACACAAAATTCAAGTGAAAGGAGTTGCAGAGCTTGGGAAAGAG

TAAGAGTGAACACCTCACCCACCTCAAGCACAAATTCAAGCGCATTTGTGAGAAGTCAATGATCGAGAAGCGTTACCTTCAATTGACGGAAGAAATTCTCAAAGAAAACCCGAATATCGG

TGCATACGAGGCACCATCATTGGATGTAAGACACAAAATTCAGGTGAAAGGAGTTGCAGAGCTTGGGAAA


190

91.05

13

Unigene17201_All

stilbene synthase

Polygonum cuspidatum

gi|91984065|gb|ABE68892.1|

GGGAAGAAGACGACCGGAGAT/GAATCGGAACACTTCGCATGAC

GGGAAGAAGACGACCGGAGATGGGTTCGAGTGGGGCGTCGCGATTGGATTGGGGCCTGGGCTTACCGTTGAGACCGTTGTCATGCGAAGTGTTCCGATTCCG

TGGGGCCTGGGCTTACCGTTGAGACCGTTGTCATGCGAAGTGTTCCGATTCA

52

98.08


Verilənlər bazası müəlliflik hüququ ilə müdafiə olunur ©kagiz.org 2016
rəhbərliyinə müraciət